Skip to main content
Research and analysis

Precision bred organism marketing notice (reference: PBM/26/SOLY/001)

Published 27 August 2026

Applies to England

Information provided to the Secretary of State alongside a notice of intention to market a precision bred plant under schedule 2 of the Genetic Technology (Precision Breeding) Regulations 2025.

1. Name and address of the person with overall responsibility for marketing the precision bred plant

John Innes Centre, Norwich Research Park, Colney Lane, Norwich,  NR4 7UH  

2. General description of the precision bred plant

a) Genus and species

Solanum lycopersicum

b) Intended alterations to characteristics of the plant

Increased accumulation of pro-Vitamin D3 in plant tissues, especially leaves and fruits.

c) Types of genetic changes introduced to cause these alterations

Insertion-deletion mutation (indel) in one nuclear gene.

d) Techniques of modern biotechnology used to make these genetic changes

Solanum lycopersicum (tomato) plants of cv. Money Maker were transformed with a site-directed endonuclease (CRISPR-Cas9) and two specific guide RNAs (using Agrobacterium) to target exon 2 of the Sl7-DR2 (Solyc06g074090) gene encoding for a reductase which uses Pro-VitaminD3 as a substrate.

3. Intended use of the precision bred plant

Commercialised in England for use in human nutrition as a biofortified food to counteract endemic Vitamin D deficiency, especially in autumn and winter seasons. Its intended final end-consumer product is for fresh consumption as well as processed. Also, to be cultivated in England to produce a (pro-)Vitamin D formulation suitable for the production of vitaminic supplements and/or as ingredient for food biofortification. Such commercialization will follow future legislation directives regarding the listing of precision bred plant varieties in England. 

4. Intended genetic changes made

(a) the details of genetic changes made

The genetic change induced by the Agrobacterium-mediated stable transformation of CRISPR-Cas9 and two specific sgRNAs is a 108-bp deletion within exon 2 of the Solanum lycopersicum 7-dehydrocholesterol reductase 2 (Sl7-DR2) gene (AGI code: Solyc06g074090). The mutation resulted in gene knock-out and protein loss-of-function. 

(b) the location of genetic changes

With reference to the annotated Solanum lycopersicum genome assembly SL2.50 ITAG2.4, the location of the deletion occurs at base pair 343 of the mRNA of the gene Solyc06g074090; or, within the same annotated genome assembly, at base pair 45,796,687 on chromosome 6. The mutation has created a loss of 108bp compared to the reference genome.

(c) the stability of genetic changes

Genotyping of 5 subsequent selfing generations as well as outcrossing in different elite tomato germplasm as shown the stability of the genetic changes. The increased pro-Vitamin D3 phenotype can only be achieved when both Sl7dr-2 mutated alleles are present ( homozygous) within a plant.

d) when a genetic change involves the insertion of any genetic material, a description of all the genetic elements inserted and the organism from which they originated

Not applicable – no inserted genetic material.

e) the purpose of the genetic changes described above in sub-paragraphs (a) to (d), including how they alter the characteristics of the precision bred plant

The 108bp deletion causes the knock-out of the tomato 7-dehydrocholesterol (7-DHC) reductase 2 gene, and consequently its loss of function. This results in the bioaccumulation of 7-DHC, which is also known as pro-Vitamin D3, in mutant plant tissue. UV-B light treatments have proved the conversion of 7-DHC to Vitamin D3 at a level similar to government approved Vitamin D fortification. 

5. Unintended genetic changes made

(a) the details of genetic changes made

Not present – resequencing of the recessive mutant plants and bioinformatic analysis against the reference tomato genome has revealed no off-target mutations by the site-directed nuclease. 

(b) the location of genetic changes

Not present – resequencing of the recessive mutant plants and bioinformatic analysis against the reference tomato genome has revealed no off-target mutations by the site-directed nuclease. 

(c) the stability of genetic changes

Not present – resequencing of the recessive mutant plants and bioinformatic analysis against the reference tomato genome has revealed no off-target mutations by the site-directed nuclease. 

6. How the intended genetic changes were introduced

(a) which techniques of modern biotechnology were used

Solanum lycopersicum (tomato) plants were stably transformed with a site-directed endonuclease (CRISPR-Cas9) and two appropriate guide RNAs (using Agrobacterium tumefaciens) to target exon 2 of the Solanum lycopersicum 7-dehydrocholesterol reductase 2 (Sl7-DR2) gene (AGI code: Solyc06g074090). These two edits have been targeted to two independent sites within exon 2 to generate lesions that ultimately caused the deletion of 108bp with the exon itself, causing the gene knock-out and protein loss of function. 

(b) information about any transgenic intermediates used

Two specific target sequences in exon 2 of the Sl7-DR2 (Solyc06g074090) were introduced into the sgRNA scaffold by PCR. To make the sgRNA-expression cassette, each sgRNA amplicon and a synthesized U6-III promoter (pICSL90001) from Arabidopsis thaliana were cloned into a GoldenGate Level 1 acceptor (pICH47732 and pICH47742). A Level 2 binary vector, pICSL002203, containing the Cas9-expression cassette and kanamycin-resistance-expression (nptII – from Escherichia coli Tn5 transposon) cassette, was used as the destination vector to generate the Sl7-DR2–CRISPR–Cas9 construct. sgRNA efficiency was tested by co-transformation of tomato using Agrobacterium rhizogenes (strain ArATCC15834). Stable transformations were conducted after the sgRNA efficiency check. 

The Sl7-DR2–CRISPR–Cas9 construct was transformed into Agrobacterium tumefaciens (strain AGL1) for stable transformation, which was undertaken using cotyledons as initial explants. 

7. Analysis and procedures used

(a) description of the analysis and procedures used to confirm the plant only contains genetic sequences that could arise by traditional processes.

DNA was isolated from the finely ground powder of leaf tissues using DNeasy Plant Mini Kits (Qiagen) following the manufacturer’s instructions. The Sl7-DR2-knockout lines have been tested for the presence of the Cas9 gene (primers AGGGACATGTACGTGGATCAGGAAC and GAATTTGGGCCACGTGCTTGGT; expected amplicon length 345bp), sgRNA (primers GCGCGGTGTCATCTATGTTA and TTCTCTTAGGTTTACCCGCC; expected amplicon length 652bp), and NptII gene (primers ATGGATTGCACGCAGGTTCT and TTTCGCTTGGTGGTCGAATG; expected amplicon length 401bp) by PCR analysis. All lines have returned no amplification, demonstrating the presence of only genetic sequences that could arise from traditional processes. 

8. Other precision bred plants covered by this marketing notice

(a) Total number of precision bred plants being notified 

Not applicable – only one plant being notified.

(b) Confirmation of precision breeding criteria

Not applicable – only one plant being notified.

(c) Variations in intended genetic changes introduced

Not applicable – only one plant being notified.

(d) Variations in unintended genetic changes introduced

Not applicable – only one plant being notified.